View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_16 (Length: 435)
Name: NF10201A_low_16
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 73 - 420
Target Start/End: Original strand, 45681878 - 45682231
Alignment:
| Q |
73 |
gaaccttagtcattgaaggtaggagtcaataggtatgtcaagttctcaaattgaaccgtcctaataatc-----aagacagacaatagttgagacaaatc |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45681878 |
gaaccttagtcattgaaggtaggagtcaataggtatgtcaagttctcaaattgaaccgtcctaataatcaaatcaagacagacaatagttgagacaaatc |
45681977 |
T |
 |
| Q |
168 |
taatccaaaatcacttgtataatatgctgtacagtatattataattaatttgtcttatcaatgctgagctgggattgtttatatannnnnnnnnnnnnnn |
267 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45681978 |
taatccaaaatcacttgtacaatatgctgtacagtatattataattaatttgtcttatcaatgctgagctgggattgtttatatatgtgtgtgtgttttt |
45682077 |
T |
 |
| Q |
268 |
nnnnnnnnngaaattttagtaattgtggcccctggtcccccatttatattctgcagccaagatgacttacataaggaaagaaatgtgtggcattattgtc |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45682078 |
gtgtatgtggaaattttagtaattgtggcccctggtcccccatttatattctgcagccaagatgacttacataaggaaagaaatgtgtggcattattgtc |
45682177 |
T |
 |
| Q |
368 |
catgggattatgtgatattaatc-tttgtaggacatacctttaattaagcttat |
420 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45682178 |
catgggattatgtgatattaatcttttgtaggacatacctttaattaagcttat |
45682231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 20 - 49
Target Start/End: Original strand, 45681795 - 45681824
Alignment:
| Q |
20 |
acaagaaacatgcatgtatgggaaggactg |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45681795 |
acaagaaacatgcatgtatgggaaggactg |
45681824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University