View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_166 (Length: 255)
Name: NF10201A_low_166
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_166 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 34571157 - 34570946
Alignment:
| Q |
18 |
gacatcagatcctcaatggaatggtttgtccttctgacttgccacttaattgctnnnnnnnttgtttcaatttgaatgtttatttacttatattctgtat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34571157 |
gacatcagatcctcaatggaatggtttgtccttctgacttgccacttaattgctaaaaaaattgtttcaatttgaatgtttctttacttatattctgtat |
34571058 |
T |
 |
| Q |
118 |
tggttttatatactaatatgcagagatattagagtttgatgctatggaagaaccaccatcagttttgtatgtggaagtttttgattttgacggtccattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34571057 |
tggttttatatactaatatgcagagatattagagtttgatgctatggaagaaccaccatcagttttgtatgtggaagtttttgattttgacggtccattt |
34570958 |
T |
 |
| Q |
218 |
gaccaggatgtt |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34570957 |
gaccaggatgtt |
34570946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University