View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_173 (Length: 252)
Name: NF10201A_low_173
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_173 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 28155641 - 28155843
Alignment:
| Q |
1 |
aatatagaaagcaagaaatcatagagaaactcaaagaatggttatttttggtgtttggttactgggatgatttcacgtgagagttctgccacttgtgtcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28155641 |
aatatagaaagcaagaaatcatagagaaactcaaagaatggttatttttggtgtttggttactgggatgatttcacgtgagagttctgccac-tgtgtcc |
28155739 |
T |
|
| Q |
101 |
gtgagttttgcaaaacctgaatgaacagaacagtttggagaaaccaacattaaccaaaccaaaccactttaaccacagtaagtgtttccattttcatgga |
200 |
Q |
| |
|
||||||||||||||||| |||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28155740 |
gtgagttttgcaaaacccgaat-----gaacagtttcgagaaaccaacatt-----aaccaaaccactttaaccacagtaagtgtctccattttcatgga |
28155829 |
T |
|
| Q |
201 |
ctcattgcctcaca |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28155830 |
ctcattgcctcaca |
28155843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 216 - 252
Target Start/End: Original strand, 28155861 - 28155897
Alignment:
| Q |
216 |
aatgttctgctcaatgaatcaaaatgtgacgaagcaa |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28155861 |
aatgttctgctcaatgaatcaaaatgtgaagaagcaa |
28155897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University