View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_179 (Length: 251)
Name: NF10201A_low_179
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_179 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 9 - 247
Target Start/End: Complemental strand, 11381271 - 11381033
Alignment:
| Q |
9 |
atcatagagtaagatctatcagctctgcatccgaaagtggaaggagcatggcatcatctgtttcttcttcagaacgattttcatcgtttgaaacagcatt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
11381271 |
atcatagagtaagatctatcagctctgcatccgaaagtggaaggagcatggcatcatctgtttcttcttcagaacgattttcatcgtttgaaacggtatt |
11381172 |
T |
 |
| Q |
109 |
gaccccaaatttgactagtgatggcaatgagagtttgttggacttgaaaatgagttacctgtctagtattaaagaggagaatctttgtcattcatcacct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11381171 |
gaccccaaatttgactagtgatggcaatgagagtttgttggacttgaaaatgagttacctgtctagtattaaagaggagaatctttgtcattcatcacct |
11381072 |
T |
 |
| Q |
209 |
cctggtgtgctggtacacattcttttcctcattaagagt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11381071 |
cctggtgtgctggtacacattcttttcctcattaagagt |
11381033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University