View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_190 (Length: 250)
Name: NF10201A_low_190
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10201A_low_190 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 22 - 215
Target Start/End: Complemental strand, 7617719 - 7617528
Alignment:
Q |
22 |
catataataaaacaatgatgcatgtgatttcaatgaatgtgtgaagccaatagggtgtgcttttataagcttctgttctgtctttaaagtgnnnnnnnnn |
121 |
Q |
|
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7617719 |
catataagaaatcaatgatgcatgtgatttcaatgaatgtgtgaagccaatagggtgtgcttttataagcttctgttctgtctttaaagtgaaaaaaa-- |
7617622 |
T |
 |
Q |
122 |
ccggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgctaattatatttagtttatacttcaaaataaattaactaac |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7617621 |
ccggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgctaattatatttagtttatacttcaaaataaattaactaac |
7617528 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University