View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10201A_low_192 (Length: 250)

Name: NF10201A_low_192
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10201A_low_192
NF10201A_low_192
[»] chr2 (1 HSPs)
chr2 (7-250)||(21642420-21642663)


Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 7 - 250
Target Start/End: Original strand, 21642420 - 21642663
Alignment:
Q  7 actctttactttaaattaaaccccggcccccatttatctcacgcccgtcatctcttcgactcacttcacgtcaaagatgttatctcatggacttcactta 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  21642420 actctttactttaaattaaaccccggcccccatttatctcacgcccgtcatctcttcgactcacttcacgtcaaagatgtcatctcatggacttcactta 21642519  T
Q  107 tctccggttacactcgctccggccagccacatcagtcgatatctttattctacgaaatgttggcatttcctattcaacccaatgcttttactctatcttc 206  Q
    ||||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  21642520 tctccggttacactcgctccgacctgccacatcaatcgatatctttattctacgaaatgttggcatttcctgttcaacccaatgcttttactctatcttc 21642619  T
Q  207 cgttattaaagcttgttctacgttgaatgacgtaaaccttggga 250  Q
     ||||| |||||||||||| |||| |||||||||||||||||||    
T  21642620 tgttatcaaagcttgttctgcgttaaatgacgtaaaccttggga 21642663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University