View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_21 (Length: 425)
Name: NF10201A_low_21
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 3e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 285 - 408
Target Start/End: Complemental strand, 15128565 - 15128439
Alignment:
| Q |
285 |
gttaatatattaggttttgacataaatat---gtcatgttgaaggtttcagtttttgcatgacgtattttacgtaataggttacctaccaatgataattt |
381 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15128565 |
gttaatatattaggttttgacataaatatcatgtcatgttgaaggtttcagtttttgcatgacgtcttttacgtaataggttacctaccaatgataattt |
15128466 |
T |
 |
| Q |
382 |
ggctaggcgtggtgtaattactgatga |
408 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
15128465 |
ggctaggcgtggtgtaattactcatga |
15128439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 7 - 144
Target Start/End: Complemental strand, 5251406 - 5251279
Alignment:
| Q |
7 |
ttcattcctttgtatannnnnnncgattgttttaaaattatcatggatgaacctgtttgttaaaattgtttgcattatacacttatctttcatttccttc |
106 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5251406 |
ttcattcctttgtatatttttttcgattgttttaaaattatcatggatgaacctgtttgttaaaattgtttgcatta----------tttcatttccttc |
5251317 |
T |
 |
| Q |
107 |
gcttcatcatcgctctagtgcttaaccactattcttat |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5251316 |
gcttcatcatcgctctagtgcttaaccactattcttat |
5251279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University