View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_210 (Length: 245)
Name: NF10201A_low_210
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_210 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 20 - 234
Target Start/End: Complemental strand, 32524959 - 32524741
Alignment:
| Q |
20 |
aatacgaagaagttttatttttggtaactacaatcaatacaaagaagttggttatgccttaacgtgcattttt--tatgagttagtgggtagttacttaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
32524959 |
aatacgaagaagttttatttttggtaactacaatcaatacaaagaagttggttatgccttaacgtgcattttttatatgagatagtgggtagttacttaa |
32524860 |
T |
|
| Q |
118 |
ttttacnnnnnnnnnnnnnnnnnnnntcgttaaagggtctttaaatggaagttaac--aaaatgaaagtagaaatggattaggagaatagttagttatta |
215 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32524859 |
ttttacaaaacaaaaaggagaaaaaatcgttaaagggtctttaaatggaagttaacaaaaaatgaaagtagaaatggattaggagaatagttagttatta |
32524760 |
T |
|
| Q |
216 |
acgtacacacatccttcat |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32524759 |
acgtacacacatccttcat |
32524741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University