View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_214 (Length: 244)
Name: NF10201A_low_214
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_214 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 28 - 244
Target Start/End: Original strand, 11380728 - 11380941
Alignment:
| Q |
28 |
gcattgacttaaacatgataatctatagttctacacatttaccttgcgtatagtatcaatgacatctttttcagctttgcgacgcttaacagtttcttga |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11380728 |
gcattgacttaaacatgataatctatagttctacacatttaccttgcgtatagtatcaatgacatctttttcagctttgcgacgcttaacagtttcttga |
11380827 |
T |
 |
| Q |
128 |
tatgcatcccacctagccttcacagcctccgcaatagcctgttcaagttgatcatagacactcttgtccattcctctatcctgctagtagtgttcaatca |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
11380828 |
tatgcatcccacctagccttcacagcctccgcaatagcctgttcaagttgatcatagacactctcgtccattcctctatcctgc---tagtgttcaatca |
11380924 |
T |
 |
| Q |
228 |
caatgtacaaaatgtta |
244 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
11380925 |
caatgtacaaaatgtta |
11380941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University