View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_220 (Length: 243)
Name: NF10201A_low_220
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10201A_low_220 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 7 - 243
Target Start/End: Complemental strand, 12157876 - 12157640
Alignment:
Q |
7 |
tttggagttccaattttcaaaggtagaccaaaannnnnnnattgtctaacctattgctaacaaaatcaagctgaaattatctacttggaaatcatctttg |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
T |
12157876 |
tttggagttccaattttcaaaggtagaccaaaatttgtttattgtctaacctattgctaacaaaaccaagctgaaattatctgcttggaaatcatctttg |
12157777 |
T |
 |
Q |
107 |
ctgatttatggcccttctgtcaattctttgcttgtttttactttaaaagacattaagagatgtaaacttgagagattgtttatgaagttgctgctttaga |
206 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
12157776 |
ctgatttatggcccttctgtcaattctttgcttgtttttactttaaaagacattaagagatataaacttgagagattgtttatgaagttgctgctttaga |
12157677 |
T |
 |
Q |
207 |
agctagcatgctagtcaaggttgttaaaacttaaagg |
243 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
12157676 |
agctagcatgctagtcaaggttgttaaaacttaaagg |
12157640 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University