View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_221 (Length: 243)
Name: NF10201A_low_221
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_221 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 10 - 243
Target Start/End: Complemental strand, 42104312 - 42104079
Alignment:
| Q |
10 |
gatgaagagattgaagttgaagatttggagaggcgaatgtggaaggatcgtatcaaactccaaaggctcaaggaaaaacaaaagcttgcagcacaagaag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42104312 |
gatgaagagattgaagttgaagatttggagaggcgaatgtggaaggatcgtatcaaactccaaaggctcaaggaaaaacaaaagcttgcagcacaagaag |
42104213 |
T |
|
| Q |
110 |
ctgcagagaagcaaaagccaaggcagtctcaggcacaagaaaattactcttatatacatgcaaacaacatagtttctttggaaaacatgtatgcgagtgg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42104212 |
ctgcagagaagcaaaagccaaggcagtctcaggcacaagaaaattactcttatatacatgcaaacaacatagtttctttggaaaacatgtatgttagtgg |
42104113 |
T |
|
| Q |
210 |
aaggccattgcactaccctcctatcatgcctcat |
243 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
42104112 |
aaggccattgcactaccctcctgacatgcctcat |
42104079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 10 - 137
Target Start/End: Complemental strand, 42114684 - 42114557
Alignment:
| Q |
10 |
gatgaagagattgaagttgaagatttggagaggcgaatgtggaaggatcgtatcaaactccaaaggctcaaggaaaaacaaaagcttgcagcacaagaag |
109 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| || ||| |
|
|
| T |
42114684 |
gatgaagagattgaggcagaagatttggagaggcggatgtggaaggatcgtatcaaactcaaaaggctcaaggaaaaacaaaagcttgaagcgcagaaag |
42114585 |
T |
|
| Q |
110 |
ctgcagagaagcaaaagccaaggcagtc |
137 |
Q |
| |
|
| ||||||||||||||| |||||||| |
|
|
| T |
42114584 |
ccctagagaagcaaaagccgaggcagtc |
42114557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University