View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_222 (Length: 243)
Name: NF10201A_low_222
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_222 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 237
Target Start/End: Original strand, 40924840 - 40925069
Alignment:
| Q |
7 |
gaacatcctcaaagaaatgtacttgttgttacctgcattgtgtcttcattggactcaatcttgctccggcggtagtgcctgcacgacgttcaactcagtg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40924840 |
gaacatcctcaaagaaatgtacttgttgttacctgtattgtgtcttcattggactcaatcttgctccggcggtagtgcctgcacgacgt-caactcagtg |
40924938 |
T |
 |
| Q |
107 |
aggggcaaaggtgccaccgctgcccgtggtggtttgggcggtgaacgcagccattttaagaaagttggactgtatgcccagatcaatatcactgcaatag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
40924939 |
aggggcaaaggtgccaccgctgcccgtggtggtttgggaggtgaacgcagccattttaagaaagttggaccgtatgccaagatcaatatcactgcaatag |
40925038 |
T |
 |
| Q |
207 |
caaccacaacaatggaagcaaacagtataag |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40925039 |
caaccacaacaatggaagcaaacagtataag |
40925069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University