View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_224 (Length: 242)
Name: NF10201A_low_224
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_224 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 15439789 - 15440020
Alignment:
| Q |
1 |
tggattaaaatcatcaaagccctacgccaatgctaagtcaaggtcagtcaaatcgctagtacaaagacctggattaaaacaactatcacggtgtgtggct |
100 |
Q |
| |
|
|||||||||||||||||| ||| | | ||||||||||||||| ||||||||||| ||||| |||| ||||||||||||||||| |||| ||||||||||| |
|
|
| T |
15439789 |
tggattaaaatcatcaaaacccgaggtcaatgctaagtcaagttcagtcaaatctctagtccaaaaacctggattaaaacaaccatcagggtgtgtggct |
15439888 |
T |
|
| Q |
101 |
tcacctaaaatggcaccaattcctgttgaaggatctagttttgaaatacagtctcgacatgtctcggccttactatctcaagtgtccaaaggcaaagaac |
200 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||| ||||||| ||| |||||||| |||| |
|
|
| T |
15439889 |
tcacctaaaatgacaccaatccctgttgaaggatctagtttcgaaatacagtctcgacatgtctcggcctcactgtctcaagagtctaaaggcaatgaac |
15439988 |
T |
|
| Q |
201 |
atcaaaagtttcaaaatattgtggaaaagaat |
232 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |
|
|
| T |
15439989 |
atcacaagtttcaaaatattgtggaaaagaat |
15440020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 8 - 79
Target Start/End: Original strand, 15439727 - 15439798
Alignment:
| Q |
8 |
aaatcatcaaagccctacgccaatgctaagtcaaggtcagtcaaatcgctagtacaaagacctggattaaaa |
79 |
Q |
| |
|
||||||||||| ||| | ||||||||||||||| | ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
15439727 |
aaatcatcaaaacccgaggccaatgctaagtcaggttcagtcaaatctctagtccaaagacctggattaaaa |
15439798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University