View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_232 (Length: 241)
Name: NF10201A_low_232
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_232 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 147 - 237
Target Start/End: Original strand, 12370016 - 12370106
Alignment:
| Q |
147 |
attaggagttgggttagggtttgtgaaaagtggagataaaaatgtgataacactgcttgaattggggaggaagcaagcaaacacgtttgac |
237 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12370016 |
attaggagtagggttagggtttgttaaaagtggagaaaaaaatgtgataacactgcttgaattggggaggaagcaagcaaacacgtttgac |
12370106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 149 - 237
Target Start/End: Original strand, 3336121 - 3336208
Alignment:
| Q |
149 |
taggagttgggttagggtttgtgaaaagtggagataaaaatgtgataacactgcttgaattggggaggaagcaagcaaacacgtttgac |
237 |
Q |
| |
|
||||||| | |||||||||||| |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3336121 |
taggagtagagttagggtttgttaaaagtagaga-aaaaatgtgataacactgcttgaattggggaggaagcaagcaaacgtgtttgac |
3336208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University