View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_237 (Length: 240)
Name: NF10201A_low_237
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_237 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 3 - 235
Target Start/End: Original strand, 40098040 - 40098290
Alignment:
| Q |
3 |
atgaagagcggagcggccgtcagtgtcacggaaattgacgtcactaccgtcgtctagaagttcggtgattccttctaagtcaccttcgttcgctaaatac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40098040 |
atgaagagcggagcggccgtcagtgtcacggaaattgacgtcactaccgtcgtctagaagttcggtgattccttctaagtcaccttcgttcgctaaatac |
40098139 |
T |
|
| Q |
103 |
atcaaccgaacggtgggatccacca------------------agtcggttacagttacggagtcggttaccagtgagttgacggtggcggaaccgtcgt |
184 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40098140 |
atcaaccgaacggtgggatccaccaagtcggttacagttacggagtcggttacagttacggagtcggttaccagtgagttgacggtggcggaaccgtcgt |
40098239 |
T |
|
| Q |
185 |
gatccggtgcgagggaagattgtctgccaagtgagaaacgagagtgaagct |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40098240 |
gatccggtgcgagggaagattgtctgccgagtgagaaacgagagtgaagct |
40098290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University