View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_238 (Length: 240)
Name: NF10201A_low_238
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_238 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 20 - 228
Target Start/End: Complemental strand, 47584080 - 47583872
Alignment:
| Q |
20 |
gaatcttgttgaaacctatgaaaggttctcggagaaatggcgattgattattagaagagtaacatgcacgtgtgcaggcagtgaatcattctactgtgtg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47584080 |
gaatcttgttgaaacctatgaaaggttctcggagaaatggcgattgattattagaagagtaacatgcacgtgtgcaggcagtgaatcattctagtgtgtg |
47583981 |
T |
|
| Q |
120 |
ctcttggagtggagccatttgtaagtctagggaaactaccaaaaggcttagcgttgatttggcacaccattttgtggtcaatatagaatgctagaaatga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583980 |
ctcttggagtggagccatttgtaagtctagggaaactaccaaaaggcttagcgttgatttggcacaccattttgtggtcaatatagaatgctagaaatga |
47583881 |
T |
|
| Q |
220 |
catcatatt |
228 |
Q |
| |
|
||||||||| |
|
|
| T |
47583880 |
catcatatt |
47583872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University