View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_243 (Length: 236)
Name: NF10201A_low_243
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_243 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 430203 - 429981
Alignment:
| Q |
14 |
agacaaaacaagagacatcaacgccgtttagtctacatcaccatcctcttaaatataaagttggtcataatatcagttaataatataaagttggtacatt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
430203 |
agacaaaacaagagacatcaacgccgtttagtctacatcaccatcctcttaaatataaagttggttataatatcagttaataatataaagttggtacatt |
430104 |
T |
|
| Q |
114 |
ttggttcacaaggaattagtccagttagaaaatgtaaagttagtgttttataaaggtagtttttgttcagttgggaaacactaaactgtttcactgagac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
430103 |
ttggttcacaaggaattagtccagttagaaaatgtaaagttagtgttttataaaggtagtttttgttcagttgggaaacactaaactgtttcaccgagac |
430004 |
T |
|
| Q |
214 |
attgtacaagtttggggctaact |
236 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
430003 |
attgtaccagtttggggctaact |
429981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University