View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_245 (Length: 235)
Name: NF10201A_low_245
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_245 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 12157628 - 12157406
Alignment:
| Q |
7 |
tttgggttgttcaacatcttttagttcatatctactgctgcatttaacttaataactttaggattttggttgtgggtgtcatattttatgtttcactgtc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12157628 |
tttgggttgttcaacatcttttagttcatatctattgctgcatttaacttaataactttaggattttggttgtgggtgtcatattttatgtttcactgtc |
12157529 |
T |
 |
| Q |
107 |
tatgtaatttgaatttgatgtaacatttttcacttgaatcgttgatgtgtacgtgtacttggttatgtttacggggttggctttgtgtaagttgtgagtt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
12157528 |
tatgtaatttgaatttgatgtaacatttttcacttgaatcgttgatgtgtacgtgtacttggttatgtttatggggttggctttgtgtaagttgtgggtt |
12157429 |
T |
 |
| Q |
207 |
tggttttgtgtttgtgttcttca |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12157428 |
tggttttgtgtttgtgttcttca |
12157406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University