View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_250 (Length: 233)
Name: NF10201A_low_250
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_250 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 214
Target Start/End: Original strand, 38483684 - 38483881
Alignment:
| Q |
17 |
tatttttggagtaagaggtgttttgagaagttgaaatggcctattgatatcgggagtagttttttcgatggaaatcgtgttgggaagacaggttttgttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38483684 |
tatttttggagtaagaggtgttttgagaaattgaaatggcctattgatattgggagtagttttttcgatggaaatcgtgttgggaagacgggttttgttg |
38483783 |
T |
|
| Q |
117 |
aacggaggtcgttttggaatttgttttggagttttgataggctttgggtgatgttgattttgtttcttcaagtggcgattattgttggttggaatgat |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38483784 |
aacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgattttgtttcttcaagtggcgattattgttggttggaatgat |
38483881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 94 - 188
Target Start/End: Original strand, 30118163 - 30118257
Alignment:
| Q |
94 |
tgttgggaagacaggttttgttgaacggaggtcgttttggaatttgttttggagttttgataggctttgggtgatgttgattttgtttcttcaag |
188 |
Q |
| |
|
|||||| ||||| || |||||||| | ||| |||||||||||| ||||| |||||||||| ||||||||| | |||||| | ||||||||||||| |
|
|
| T |
30118163 |
tgttggtaagaccggatttgttgagcagagatcgttttggaatctgtttcggagttttgacaggctttggattatgttggtgttgtttcttcaag |
30118257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 17 - 81
Target Start/End: Original strand, 30118074 - 30118138
Alignment:
| Q |
17 |
tatttttggagtaagaggtgttttgagaagttgaaatggcctattgatatcgggagtagtttttt |
81 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||| |||| | ||||||| |||||| |
|
|
| T |
30118074 |
tatttttggagtaggaggtgttttgagaagatgaaatggcctcctgatgttgggagtaatttttt |
30118138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University