View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_263 (Length: 230)
Name: NF10201A_low_263
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_263 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 224
Target Start/End: Complemental strand, 15911957 - 15911752
Alignment:
| Q |
17 |
tgccaccaaccacaaaaccctcagcgacgccaccacttctcgaccaacccttggggtgcaaactagaaccaacaccaactagaacgcgtgcaaacccata |
116 |
Q |
| |
|
|||||||||||||| |||||||| | |||||||||| | ||||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15911957 |
tgccaccaaccacagaaccctcaacaacgccaccacctatcgaccaacccttcgg-tgcaaactagaaccaacaccaactagaacacgtgcaaacccata |
15911859 |
T |
|
| Q |
117 |
actaaagttatataaaaaagaatgcaattgagaacaaaaatcgttcgccaaatctagagacccatacagtgagtgaatctaatctaaagcgggtttaaaa |
216 |
Q |
| |
|
|||||||||| |||| |||||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15911858 |
actaaagttacataacaaagaaggcaatcgagaacaaaa-tcgttcgccaaatctagagacccatacagtgagtgaatctaatctaaagcgggtttaaaa |
15911760 |
T |
|
| Q |
217 |
gataaaac |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
15911759 |
gataaaac |
15911752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University