View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_270 (Length: 230)
Name: NF10201A_low_270
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_270 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 42104024 - 42103804
Alignment:
| Q |
1 |
gggcagcatcagcatctgcagcctggcctagccgtgaacattgatccaattattaggcagccagagaatgctgcaatcactatgcctgcagcaaatatga |
100 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42104024 |
gggcagcatcagcatctgcagtccggcctagccgtgaacattgatccaatta---ggcagccagagaatgctgcaatcactatgcctgcagcaaatatga |
42103928 |
T |
|
| Q |
101 |
aaggtgacgaaatcacaggaggagacataaattatttcgctaaagacgcattccaaaacgagctggataggtttggatcaccaattactaacatgtcatt |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42103927 |
aaggtgacgaaatcactggaggagacataaattatttcgctaaagacgcattccaaaacgagctggataggtttggatcaccaatcactaacatgtcatt |
42103828 |
T |
|
| Q |
201 |
tgattttggagttcttgacaatcc |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42103827 |
tgattttggagttcttgacaatcc |
42103804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 52 - 224
Target Start/End: Complemental strand, 42113166 - 42112994
Alignment:
| Q |
52 |
attaggcagccagagaatgctgcaatcactatgcctgcagcaaatatgaaaggtgacgaaatcacaggaggagacataaattatttcgctaaagacgcat |
151 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||| |||| ||||| ||||| | ||||||| ||| |||||| | ||||||||| ||| |
|
|
| T |
42113166 |
attaggcaaccagagaatgctgcaataactatgcctgcagcaaatgtgaatggtgatgaaattatcggaggaggcatgaattatattgctaaagacacat |
42113067 |
T |
|
| Q |
152 |
tccaaaacgagctggataggtttggatcaccaattactaacatgtcatttgattttggagttcttgacaatcc |
224 |
Q |
| |
|
||| ||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42113066 |
tcccaaacgagctggataggtttggatcaccgttgagtaacatgtcatttgattttggagttcttgacaatcc |
42112994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University