View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_271 (Length: 230)
Name: NF10201A_low_271
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_271 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 30573876 - 30573653
Alignment:
| Q |
1 |
aatgtgaaagcttggttttgttgcttctgcaaattcacattagatataacatataatgcaagaaaatgtttatccaaacatatgcttaatggtttatcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30573876 |
aatgtgaaagcttggttttgttgcttctgcaaattcacagtagatataacatataatgcaagaaaatgtttatccaaacatatgcttaatggtttatcag |
30573777 |
T |
|
| Q |
101 |
tgtatttatatttggtttgtgagagagattaaaagaaatatcactactagtcatggttacattcatattataaaaagtttacccttaatattatcctcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30573776 |
tgtatttatatttggtttgtgagagagattaaaagaaatatcattactagtcatggttacattcatattataaaaagtttacccataatattatcctcaa |
30573677 |
T |
|
| Q |
201 |
cggatctcacaatgatatctgaaa |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
30573676 |
cggatctcacaatgatatctgaaa |
30573653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 30570400 - 30570277
Alignment:
| Q |
1 |
aatgtgaaagcttggttttgttgcttctgcaaattcacattagatataacatataatgcaagaaaatgtttatccaaacatatgcttaatggtttatcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30570400 |
aatgtgaaagcttggttttgttgcttctgcaaattcacagtagatataacatataatgcaagaaaatgtttatccaaacatatgcttaatggtttattag |
30570301 |
T |
|
| Q |
101 |
tgtatttatatttggtttgtgaga |
124 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
30570300 |
tgtatttatatttggcttgtgaga |
30570277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University