View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_279 (Length: 229)
Name: NF10201A_low_279
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_279 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 50 - 213
Target Start/End: Complemental strand, 3923887 - 3923724
Alignment:
| Q |
50 |
agaaacttcatcaaccacacgtaaactctatttcttacaatgtgacttcccactctatctataacaaaattacaattgcaaatgcatagatgaggaacca |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3923887 |
agaaacttcatcaaccacacgtaaactctatttcttacaatgtgacttcccactctatctataacaaaattacaattgcaaatgcatagatgaggaacca |
3923788 |
T |
 |
| Q |
150 |
tccaaataccattatgtcatatttaggaagaaaattagaattcacccacctgcatctttcatat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3923787 |
tccaaataccattatgtcatatttaggaagaaaattagaattcacccacctgcatctttcatat |
3923724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 213
Target Start/End: Original strand, 14202065 - 14202125
Alignment:
| Q |
153 |
aaataccattatgtcatatttaggaagaaaattagaattcacccacctgcatctttcatat |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||| |||| |||||||| |||| |
|
|
| T |
14202065 |
aaataccatgatgtcatatttaggaagaaatttagaattcaaccactagcatctttgatat |
14202125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 145 - 204
Target Start/End: Original strand, 7421245 - 7421304
Alignment:
| Q |
145 |
aaccatccaaataccattatgtcatatttaggaagaaaattagaattcacccacctgcat |
204 |
Q |
| |
|
||||| ||||||||||| |||| |||||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
7421245 |
aaccacccaaataccatgatgtgatattttggaagaaaattagaattcaaccaccagcat |
7421304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 151 - 208
Target Start/End: Original strand, 13573961 - 13574018
Alignment:
| Q |
151 |
ccaaataccattatgtcatatttaggaagaaaattagaattcacccacctgcatcttt |
208 |
Q |
| |
|
||||||| ||| || | ||||| |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
13573961 |
ccaaatagcatgatattatattaaggaagaaaattagaattcaaccaccagcatcttt |
13574018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University