View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_289 (Length: 229)
Name: NF10201A_low_289
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_289 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 25 - 209
Target Start/End: Complemental strand, 33496017 - 33495833
Alignment:
| Q |
25 |
tttggatgaatatctagaatcttgatattcctcaccgtgttcgagcctttatatggcatttagctcatcattgcttgcccgcccatgtcaatcttaatgc |
124 |
Q |
| |
|
||||||||||||||| || ||| ||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
33496017 |
tttggatgaatatctggactctcgatattcctcaccgtgttcgagcctttatgtggcatttagctcatcatttcttgcccacccgtgtcaatcttaatgt |
33495918 |
T |
|
| Q |
125 |
aagaggaattcagtgcgaggaatcatgcgttatgtgtgaaacttttgcggaatcccacattcatctcttctttgtttgtgcaaaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33495917 |
aagaggaattcagtgcgaggaatcatgcgttatgtgtgaaacttttgcggaatcccacattaatctcttctttgtttgtgcaaaa |
33495833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 27 - 209
Target Start/End: Original strand, 4243561 - 4243743
Alignment:
| Q |
27 |
tggatgaatatctagaatcttgatattcctcaccgtgttcgagcctttatatggcatttagctcatcattgcttgcccgcccatgtcaatcttaatgcaa |
126 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||| ||||||||| |||||| |||||||||| ||||||||||| | | ||||||||||||||||| |
|
|
| T |
4243561 |
tggatgaatatctggaatctcaatattcctcaccgtgtccgagcctttctatggcgtttagctcataattgcttgcccactcgtgtcaatcttaatgcaa |
4243660 |
T |
|
| Q |
127 |
gaggaattcagtgcgaggaatcatgcgttatgtgtgaaacttttgcggaatcccacattcatctcttctttgtttgtgcaaaa |
209 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||| ||||| ||||||||||| ||||| |||||||||||||||||| |||||| |
|
|
| T |
4243661 |
gaggaatccagtgcgaggaatcatgtgttatgtttgaaaattttgcggaatgccacactcatctcttctttgtttgcgcaaaa |
4243743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University