View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_293 (Length: 228)
Name: NF10201A_low_293
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_293 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 22 - 206
Target Start/End: Complemental strand, 6073749 - 6073565
Alignment:
| Q |
22 |
acttccatcctcctcgccggaatctctctccatcaaacctcaccgttcgtccgactttgcctacaccgccatccgcaaatccggcctcaccttccgtgac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6073749 |
acttccatcctcctcgccggaatctctctccatcaaacctcatcgttcctccgacttcgcctacaccgccatccgcaaatccggcctcaccttccgtgac |
6073650 |
T |
 |
| Q |
122 |
ttccatctcctccgccgtataggcgccggcgacataggcaccgtttacctctgtcgcctccgtgactcctccgcaaatgaactcc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6073649 |
ttccatctcctccgccgtataggcgccggcgacataggcaccgtttacctctgtcgcctccgtgactcctcctcaaatgaactcc |
6073565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 180
Target Start/End: Original strand, 37170044 - 37170181
Alignment:
| Q |
46 |
tctctccatcaaacctcaccgttcgtccgactttgcctacaccgccatccg---caaatccggcctcaccttccgtgacttccatctcctccgccgtata |
142 |
Q |
| |
|
||||||| ||||||||||||| || |||||||| || ||| |||||||||| ||| |||| ||||| || ||||||||||| |||||||||||||| |
|
|
| T |
37170044 |
tctctccctcaaacctcaccgctcctccgacttcgcttactccgccatccgtcgcaagtccgctctcacatttcgtgacttccacctcctccgccgtatc |
37170143 |
T |
 |
| Q |
143 |
ggcgccggcgacataggcaccgtttacctctgtcgcct |
180 |
Q |
| |
|
|||||||| || || || || |||||||| || ||||| |
|
|
| T |
37170144 |
ggcgccggagatatcggtactgtttacctatgccgcct |
37170181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University