View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_297 (Length: 227)
Name: NF10201A_low_297
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_297 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 31 - 206
Target Start/End: Original strand, 14956724 - 14956899
Alignment:
| Q |
31 |
cagagatgacgtttaatgctatgatgagaatgatatcgggaaaacggtattatggagatgacggagatgtgtcagatgttgaagaagctaaacaatttag |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14956724 |
cagagatgacgtttaatgctatgatgagaatgatatcgggaaaacggtattatggagatgacggagatgtgtcagatgttgaagaagctaaacaatttag |
14956823 |
T |
|
| Q |
131 |
ggagataataagtgagatgatgtctttgttaggtgctaataataagggtgattttttgcctttgttaaggttgttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14956824 |
ggagataataagtgagatgatgtctttgttaggtgctaataataagggtgattttttgcctttgttaaggttgttt |
14956899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University