View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_303 (Length: 225)
Name: NF10201A_low_303
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_303 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 23 - 211
Target Start/End: Original strand, 35650952 - 35651148
Alignment:
| Q |
23 |
taactaacttagagagacaaaagaacatggaaacaccataaactaacctatcacccttagctctaccttgtcttttataccccccatgcagtatagtaat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35650952 |
taactaacttagagagacaaaagaacatggaaacaccataaactaacctatcacccttagctctaccttgtcttttatacaccccatgcagtatagtaat |
35651051 |
T |
|
| Q |
123 |
aatagtataacattcccgtgaactataatattttctatc--------tttatttatttattttgtcctttaatcttgatgttcaactgttcatctca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35651052 |
aatagtataacattcccgtgaactataatattttctatctttatttatttatttatttattttgtcctttaatcttgatgttcaactgtttatctca |
35651148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University