View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_319 (Length: 220)
Name: NF10201A_low_319
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_319 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 22 - 202
Target Start/End: Complemental strand, 28587101 - 28586921
Alignment:
| Q |
22 |
gaaacaaagatttatacttgggaacatatggtaaacgtttaccttttcttgttaacttttctattttataaaatatgattggatttagtgaaatgatagt |
121 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28587101 |
gaaacaaagatctatacttgggaacatatggtaaacgtttacctattcttgttaacttttctattttataaaatatgattggatttagtgaaatgatagt |
28587002 |
T |
|
| Q |
122 |
atgagtgtatgacaccattagctttaatctactcatatattttaccaatctccccatatattctgtatccatatatattac |
202 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28587001 |
atgagtgtatgacaccattaactttaatctactgatatattttaccaatctccccatatattctgtatccatatatattac |
28586921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University