View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_329 (Length: 216)
Name: NF10201A_low_329
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_329 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 12 - 198
Target Start/End: Original strand, 31997902 - 31998088
Alignment:
| Q |
12 |
tccaagaatatgcctcgtggatgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattacctgctaaatt |
111 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31997902 |
tccaagaaaatgcctcgtggacgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgctaaatt |
31998001 |
T |
|
| Q |
112 |
tcatggtaacagttggtttgtttatctttctggctctgcataagaattggattttaannnnnnnaatcaaagtcttttgacctattt |
198 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
31998002 |
tcttggtcacagttggtttgtttatctttctggctctgcataagaattggattttaatttttttaatcgaagtcttttgacctattt |
31998088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 44
Target Start/End: Original strand, 31996612 - 31996644
Alignment:
| Q |
12 |
tccaagaatatgcctcgtggatgtggacttgca |
44 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
31996612 |
tccaagaaaatgcctcgtggatgtggacttgca |
31996644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 15 - 106
Target Start/End: Original strand, 15843029 - 15843120
Alignment:
| Q |
15 |
aagaatatgcctcgtggatgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattacctgct |
106 |
Q |
| |
|
||||| || ||||||||||||||||||||||| |||||| ||||||| ||||||| |||||||||||||| ||||||| |||||||||| |
|
|
| T |
15843029 |
aagaaaatacctcgtggatgtggacttgcatagtaggagatggtcttgttggagggggcaatgtgcctctggagggaagtacattacctgct |
15843120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University