View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_334 (Length: 213)
Name: NF10201A_low_334
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_334 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 22 - 192
Target Start/End: Original strand, 33649880 - 33650050
Alignment:
| Q |
22 |
tgagattgatagatccaaatttcaatacatgatttgattatttaaagnnnnnnnnnnctaaaataccgagtttaaaatcgttagcgtccgattttgatcc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33649880 |
tgagattgatagatccaaatttcaatacatgatttgattatttaaagaaaaaaaaaactaaaataccgagtttaaaatcgttagcgtccgattttgatcc |
33649979 |
T |
|
| Q |
122 |
aacggttaaatttcatatcttggtgggtctaacaatgactacttcaattttaagctctaattgcatcttcc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33649980 |
aacggttaaatttcatatcttggtgggtctaacaatgactacttcaattttaagctctaattgcatcttcc |
33650050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University