View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_336 (Length: 212)
Name: NF10201A_low_336
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_336 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 35582523 - 35582318
Alignment:
| Q |
1 |
tcattcaccaatgctttctgatcagcatccggtagtacaacgttgttaccatttaacaccatgttaaaccccgtcacattatttttcggctgataaaacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| | |
|
|
| T |
35582523 |
tcattcaccaatgctttctgatcagcatccggtagtacaacgttgttaccatttaacaccatgttaaacgctgtcacattatttttcggctgataaaatg |
35582424 |
T |
|
| Q |
101 |
ttggcaacaagccgttactgatttgatcatctttgtaaaacatttcaacagtgttatttttctcatagtagattccaatcttgttgacattatcagcctt |
200 |
Q |
| |
|
| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35582423 |
tgggcaacaagccgttaccgatttgatcatctttgtaaaacatttcaacagtgttatttttctcatagtagattccaatcttgttgacattatcagcctt |
35582324 |
T |
|
| Q |
201 |
aatgga |
206 |
Q |
| |
|
|||||| |
|
|
| T |
35582323 |
aatgga |
35582318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University