View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_345 (Length: 206)
Name: NF10201A_low_345
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_345 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 15 - 188
Target Start/End: Complemental strand, 37667652 - 37667488
Alignment:
| Q |
15 |
tgagatggagttttgtgttttgatgtttagattaagtcctcaattgatggaagagtcatggtttttgcttgaagaagcattggatcatgaacttaacaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37667652 |
tgagatggagttttgtgttttgatgtttagattaagtcctcaattgatggaagagtcatggtttttgcttgaagaagcattggatcatgaactt------ |
37667559 |
T |
|
| Q |
115 |
agcaagtagcaaccattcattttaaagagtcattgttcttttgactattttgattcttttttacatttgatatt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37667558 |
---aagtagcaaccattcattttaaagagtcattgttcttttgactattttgattcttttttacatttgatatt |
37667488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 17 - 92
Target Start/End: Original strand, 21941661 - 21941736
Alignment:
| Q |
17 |
agatggagttttgtgttttgatgtttagattaagtcctcaattgatggaagagtcatggtttttgcttgaagaagc |
92 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||| |||||||||||||||| ||||||| |||||| ||||| |
|
|
| T |
21941661 |
agatggagttttgtgttttgatgtttaggttgagtcctgaattgatggaagagtcttggttttggcttgaggaagc |
21941736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University