View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10201A_low_346 (Length: 205)

Name: NF10201A_low_346
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10201A_low_346
NF10201A_low_346
[»] chr2 (1 HSPs)
chr2 (22-183)||(25931947-25932108)


Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 22 - 183
Target Start/End: Complemental strand, 25932108 - 25931947
Alignment:
22 acacttgtcaaatagtaaaagtgtataaaactcgggagtataaatcaaacatttcagtgtgagcacaaaaagagagaggggtgatatgatggagatagca 121  Q
    ||||||||||||||| |||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
25932108 acacttgtcaaatagaaaaagtgtataaaatttgagagtataaatcaaacatttcagtgtgagcacaaaaagagagaggggtgatatcatggagatagca 25932009  T
122 atgaacaagttatattggacagtgtggatgatagtgataaccagtgttacgatattgttgga 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||    
25932008 atgaacaagttatattggacagtgtggatgatagtgataaccagtgttataatattgttgga 25931947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University