View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_349 (Length: 204)
Name: NF10201A_low_349
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_349 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 7e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 22 - 127
Target Start/End: Original strand, 29342177 - 29342282
Alignment:
| Q |
22 |
cattatactctttagatgtaataaacgttttcatgatcttgataagttaccaaaatggaatattgcttatattttcttgagaaaatttttggtgaaactt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29342177 |
cattatactctttagatgtaataaacgttttcatgatcttgataagttaccaaaatggaatattgcttatattttcttgagaaattttttggtgaaactt |
29342276 |
T |
 |
| Q |
122 |
cgttga |
127 |
Q |
| |
|
|||||| |
|
|
| T |
29342277 |
cgttga |
29342282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 34 - 127
Target Start/End: Original strand, 29358252 - 29358345
Alignment:
| Q |
34 |
tagatgtaataaacgttttcatgatcttgataagttaccaaaatggaatattgcttatattttcttgagaaaatttttggtgaaacttcgttga |
127 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29358252 |
tagatgtaataaccattttcatgatcttgataagttaccaaaatggaatattgtttatattttcttgagaaattttttggtgaaacttcgttga |
29358345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University