View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_351 (Length: 204)
Name: NF10201A_low_351
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_351 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 178
Target Start/End: Original strand, 47340278 - 47340435
Alignment:
| Q |
19 |
attagtgtattaacaccttggttatcatcagattcagtgttatgttggtcaatttacatgatcgctgtgacgagtattggagctattctaatagatactc |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47340278 |
attagtgtattaacacct-ggttatcatcagattcagtgttatgttggtcaatttacatgatcgctgtgacgagtattggagctattctaatagatactc |
47340376 |
T |
 |
| Q |
119 |
caaaaccgattagaatatgtttaattttattctatttattttcaataaagtcataacatt |
178 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47340377 |
caaaactgattagaatatgtttaattttattcta-ttattttcaataaagtcataacatt |
47340435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University