View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_39 (Length: 381)
Name: NF10201A_low_39
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 23 - 340
Target Start/End: Original strand, 35650952 - 35651277
Alignment:
| Q |
23 |
taactaacttagagagacaaaagaacatggaaacaccataaactaacctatcacccttagctctaccttgtcttttataccccccatgcagtatagtaat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35650952 |
taactaacttagagagacaaaagaacatggaaacaccataaactaacctatcacccttagctctaccttgtcttttatacaccccatgcagtatagtaat |
35651051 |
T |
|
| Q |
123 |
aatagtataacattcccgtgaactataatattttctatcttta--------tttatttattttgtcctttaatcttgatgttcaactgtttatctcaaaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35651052 |
aatagtataacattcccgtgaactataatattttctatctttatttatttatttatttattttgtcctttaatcttgatgttcaactgtttatctcaaaa |
35651151 |
T |
|
| Q |
215 |
aagacctctacattttcacagtaacaattccttttcaaccttggaatcacatactaaattctctgaaaaaggttcatcaccacaatttctgttgccacat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35651152 |
aagacctctacattttcacagtaacaattccttttcaaccttggaatcacatactaaattctctgaaaaaggttcatcaccacaatttctgttgccacac |
35651251 |
T |
|
| Q |
315 |
caaagtttttgatgtttttgcaacct |
340 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35651252 |
caaagtttttgatgtttttgcaacct |
35651277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University