View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_56 (Length: 354)
Name: NF10201A_low_56
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 209 - 349
Target Start/End: Complemental strand, 50783971 - 50783831
Alignment:
| Q |
209 |
ggttggctggcaaggacagtgtgagtcacgagtgccaaacttatgtctgaacaaataatatctgctcttatcaacatgttctttcttgccacctcataca |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50783971 |
ggttggctggcaaggacagtgtgagtcacgagtgccaaacttatgtctgaacaaataatatctgctcttatcaacatgttctttcttgccacctcataca |
50783872 |
T |
|
| Q |
309 |
tttgtcacacaaatattttatacattttcagagaatgtcct |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50783871 |
tttgtcacacaaatattttatacattttcagagaatgtcct |
50783831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 16 - 144
Target Start/End: Complemental strand, 50784164 - 50784036
Alignment:
| Q |
16 |
atgaaacttatattaggagatatatgaatgaaagatgctatgatagtattaatttgttttttgtgataagaagtgtgtgaggtctgacaagttgtcttgc |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
50784164 |
atgaaacttatattaggagatatgtgaatgaaagatgctatgatagtattaatttgttttttgtgataaaaagtgtgtgtggtctgacaagttgtcttgc |
50784065 |
T |
|
| Q |
116 |
atggagcagacagcgacgttgtgcagaac |
144 |
Q |
| |
|
|||| |||||||||||||||||||||||| |
|
|
| T |
50784064 |
atggtgcagacagcgacgttgtgcagaac |
50784036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University