View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_80 (Length: 326)
Name: NF10201A_low_80
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 4 - 255
Target Start/End: Original strand, 44535085 - 44535336
Alignment:
| Q |
4 |
atagaggaaaaggttactaccaacatgagggagaagatgagaaactcatcaacttcattatcatatgatcataatgaggtaaagaaagttgaggactcct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44535085 |
atagaggaaaaggttactaccaacatgagggagaagatgagaaactcatcaacttcattatcatatgatcataatgaggtaaagaaagttgaggactcct |
44535184 |
T |
 |
| Q |
104 |
ttgaaacaaataagaagctagagaggaagactacagaagacatcaatgccagtgctgatgccttcatcaagaatttcaggaaacaactcgtgattcaaag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44535185 |
ttgaaacaaataagaagctagagaggaagactacagaagacatcaatgccagtgctgatgccttcatcaagaatttcaggaaacaactcgtgattcaaag |
44535284 |
T |
 |
| Q |
204 |
gcttcaatccattgagaattatgagaaaatgcttgcaaggggtctctagcac |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44535285 |
gcttcaatccattgagaattatgagaaaatgcttgcaaggggtctctagcac |
44535336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 138 - 245
Target Start/End: Complemental strand, 2579963 - 2579856
Alignment:
| Q |
138 |
agaagacatcaatgccagtgctgatgccttcatcaagaatttcaggaaacaactcgtgattcaaaggcttcaatccattgagaattatgagaaaatgctt |
237 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||| ||||| || ||| | || || || |||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2579963 |
agaagatatcaatgctagtgctgatgccttcattaagaactttaggcagcagcttatgcttcagaggcttcaatctattgagaattatgagaaaatgctt |
2579864 |
T |
 |
| Q |
238 |
gcaagggg |
245 |
Q |
| |
|
|| ||||| |
|
|
| T |
2579863 |
gctagggg |
2579856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University