View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_88 (Length: 316)
Name: NF10201A_low_88
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_88 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 9 - 312
Target Start/End: Original strand, 52609133 - 52609432
Alignment:
| Q |
9 |
aacatagacattccaatactcaaagtcaatgatatctcaaggtattttaaggcttttctcgaaatgagaatgtgcacatgattttgcagtggtttattct |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52609133 |
aacaaagacattccaatactcaaagtcaatgatatctcaaggtgttttaaggcttttctcgaaatgagaatgtgcacatgattttgcagtggattattct |
52609232 |
T |
|
| Q |
109 |
atttttagattaattttcagttcgttcgttgcattagtacgggcttttagacggctgcacactattgcctctgagagccttatttagtgtttcacggctc |
208 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52609233 |
atttttagatt----ttcagttcgttcgttgcattagtacgtgcttttagacggctgcacactattgcctctgagagccttatttagtgtttcacggctc |
52609328 |
T |
|
| Q |
209 |
tttacatatataagagatccacgactgcatttccgcacctcattttaccttagcccacaagtcattgtcttgttctttgaggcgaagacttaaagattct |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52609329 |
tttacatatataagagatccacgactgcattttcgcgcctcattttaccctagcccccaagtcattgtcttgttctttgaggcgaagacttaaagattct |
52609428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University