View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_90 (Length: 313)
Name: NF10201A_low_90
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_90 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 12 - 308
Target Start/End: Original strand, 20586500 - 20586797
Alignment:
| Q |
12 |
tgagatgaactccttatccattgatttgatgtcgttaagtaatttaaattctaatattcgttg-caacagtctagaatgcattggttaaaggatggatat |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
20586500 |
tgagatgaactccttatccgttgatttgatgtcgttaagtcatttaaattctaatattcgttggcaacagtctagaatgcattggttaaaggatggagat |
20586599 |
T |
|
| Q |
111 |
gccaataccaagttttttcatggtattttagcggcaaggaggcttggtaattttattgttaaaattgatgttaatggaagtgaggtggaaggtgtagaga |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||| |||||||||| |||||| |||||||||||||||| |||||||||||| |
|
|
| T |
20586600 |
gccaataccaagttttttcatgatattttagcggcaaggaggcgtggtaattctattgttaaacttgatgataatggaagtgaggtgcaaggtgtagaga |
20586699 |
T |
|
| Q |
211 |
gtattcgaggagttgtgttcaatcattttaagaatcattttcgatctgttatggtggatcgccttggggcggaaaatctcaattttaatatgattggt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20586700 |
atattcgaggagttgtgttcaatcattttaagaatcattttcgatctgttatggtggatcgccttggggcggaaaatctcaattttaatatgattggt |
20586797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University