View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_92 (Length: 312)
Name: NF10201A_low_92
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_92 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 69 - 126
Target Start/End: Complemental strand, 51376286 - 51376229
Alignment:
| Q |
69 |
tcataggtaataggtattgaaggaacacttatgtaaatgactaaaagaggattggaaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
51376286 |
tcataggtaataggtattgaaggaacacttctgtaaatgaataaaagaggattggaaa |
51376229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 144 - 189
Target Start/End: Original strand, 51821029 - 51821074
Alignment:
| Q |
144 |
cttttaggtaagcctttattccatcatgaaagaaatttgactcttg |
189 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
51821029 |
cttttaggtaagtctttattatatcatgaaagaaaattgactcttg |
51821074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University