View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201_high_15 (Length: 250)
Name: NF10201_high_15
Description: NF10201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 11 - 249
Target Start/End: Original strand, 7544234 - 7544472
Alignment:
| Q |
11 |
cagagaacgacgacctggtgtattctggggttccatcactccacccccaaggaggcctttcatcgtctaaatgatagattttacttgcctggtttgaata |
110 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544234 |
cagagaacgacgacctggtgttttctggggttccatcactccacccccaaggaggcctttcatcgtctaaatgatagattttacttgcctggtttgaata |
7544333 |
T |
 |
| Q |
111 |
tattgccacattcgaagaccacatccactgaggcaaggaaggagggagacggggaggatcgctctcggtgtctaagtcaagcaaagagctatatatagta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544334 |
tattgccacattcgaagaccacatccactgaggcaaggaaggagggagacggggaggatcgctctcggtgtctaagtcaagcaaagagctatatatagta |
7544433 |
T |
 |
| Q |
211 |
gtatcctcttcagaaccaatagagaacacacttccttgg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7544434 |
gtatcctcttcagaaccaatagagaacacgcttccttgg |
7544472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University