View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201_low_17 (Length: 299)
Name: NF10201_low_17
Description: NF10201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 5 - 281
Target Start/End: Original strand, 20586520 - 20586797
Alignment:
| Q |
5 |
ttgatttgatgtcgttaagtaatttaaattctaatattcgttg-caacagtctagaatgcattggttaaaggatggatatgccaataccaagttttttca |
103 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20586520 |
ttgatttgatgtcgttaagtcatttaaattctaatattcgttggcaacagtctagaatgcattggttaaaggatggagatgccaataccaagttttttca |
20586619 |
T |
|
| Q |
104 |
tggtattttagcggcaaggaggcttggtaattttattgttaaaattgatgttaatggaagtgaggtggaaggtgtagagagtattcgaggagttgtgttc |
203 |
Q |
| |
|
|| |||||||||||||||||||| |||||||| |||||||||| |||||| |||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
20586620 |
tgatattttagcggcaaggaggcgtggtaattctattgttaaacttgatgataatggaagtgaggtgcaaggtgtagagaatattcgaggagttgtgttc |
20586719 |
T |
|
| Q |
204 |
aatcattttaagaatcattttcgatctgttatggtggatcgccttggggcggaaaatctcaattttaatatgattggt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20586720 |
aatcattttaagaatcattttcgatctgttatggtggatcgccttggggcggaaaatctcaattttaatatgattggt |
20586797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University