View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201_low_18 (Length: 295)
Name: NF10201_low_18
Description: NF10201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10201_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 279
Target Start/End: Original strand, 28734639 - 28734900
Alignment:
Q |
18 |
aatggccccacaagggtgagcccctatagaagattcatcacaattgaacttaatagttccaccgctaggaggtttccaagcaatttcagtgaagggactg |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
28734639 |
aatggccccacaagggtgagcccctatagaagattcatcacaattgaacttaatagttccaccgctagtaggtttccaagcaatttcagtgaagggactg |
28734738 |
T |
 |
Q |
118 |
acccttttagatttgagagggatgtgaaacagttgagagattttgtagtcctgcatagctgaagcaccattgaccaaaattaagctatgaccgagcttga |
217 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
28734739 |
acccttttagatttgagagggatgtgaaacagttgagagattttgtagtcctgcatagctgaagcaccattgaccaaaattaagctatgactgagcttga |
28734838 |
T |
 |
Q |
218 |
cctcagcaatcagtgttgaataaggtggtcaaagcttgatgtttgctttggaaatatctctg |
279 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28734839 |
cctcagcaatcagtgttgaataaggtggtcaaagcttgatgtttgctttggaaatatctctg |
28734900 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 107
Target Start/End: Original strand, 8634481 - 8634570
Alignment:
Q |
18 |
aatggccccacaagggtgagcccctatagaagattcatcacaattgaacttaatagttccaccgctaggaggtttccaagcaatttcagt |
107 |
Q |
|
|
|||||| ||||||||||| ||||| | ||||||| |||||||||||||||| | ||| ||||| ||||||| |||||| || |||||| |
|
|
T |
8634481 |
aatggcaccacaagggtgtgccccaacagaagatccatcacaattgaacttgacagtaccacctgtaggaggaatccaagtaacttcagt |
8634570 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University