View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201_low_26 (Length: 248)
Name: NF10201_low_26
Description: NF10201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 10 - 237
Target Start/End: Original strand, 15128439 - 15128669
Alignment:
| Q |
10 |
tcatcagtaattacaccacgcctagccaaattatcattggtaggtaacctattacgtaaaatacgtcatgcaaaaactgaaaccttcaacatgac---at |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
15128439 |
tcatgagtaattacaccacgcctagccaaattatcattggtaggtaacctattacgtaaaagacgtcatgcaaaaactgaaaccttcaacatgacatgat |
15128538 |
T |
 |
| Q |
107 |
atttatgtcaaaacctaatatattaacnnnnnnnnnnnnatcaattatctcttctaattaatattttgttcgtcactctcaattcattctatatatttta |
206 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15128539 |
atttatgtcaaaacctaatatattaactattttttttttatcaattatatcttctaattaatattttgttcgtcactctcaattcattctatatatttta |
15128638 |
T |
 |
| Q |
207 |
cttcatgataacgatgaatacataacatctg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15128639 |
cttcatgataacgatgaatacataacatctg |
15128669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University