View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201_low_28 (Length: 244)
Name: NF10201_low_28
Description: NF10201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 32534407 - 32534181
Alignment:
| Q |
1 |
ccagtactattgatactgaaattcaagcatgattgaattgtgtaggttagaaggatccaatataatatttgctagctattttggagtgtctaggctgtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32534407 |
ccagtactattgatactgaaattcaagcatgattgaattgtgtaggttagaaggatccaatataatatttgctagctgttttggagtgtctaggctgtta |
32534308 |
T |
|
| Q |
101 |
gtcatgcccttatttgcgagggttactagtccctgttggttaatgaatgttaactcaagcctttagacttcatttctcaccacgcgcctgcttttacttc |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
32534307 |
gtcatgcccttatttgtgagggttactagtccctgttggttaatgaatgttaactcaagcctttagacttcatttctcaccacgcgcttgctcttacttc |
32534208 |
T |
|
| Q |
201 |
tgtgagggtcatctcgtgcattagttg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32534207 |
tgtgagggtcatctcgtgcattagttg |
32534181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 86 - 175
Target Start/End: Complemental strand, 32549534 - 32549445
Alignment:
| Q |
86 |
gtgtctaggctgttagtcatgcccttatttgcgagggttactagtccctgttggttaatgaatgttaactcaagcctttagacttcattt |
175 |
Q |
| |
|
||||||||||||||||| ||||||| ||| || | | | | |||| |||||| ||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
32549534 |
gtgtctaggctgttagtagtgccctttattgtgacgctcatttgtccttgttggctaatgaatgttaactcaagtctttagatttcattt |
32549445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University