View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201_low_32 (Length: 227)
Name: NF10201_low_32
Description: NF10201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201_low_32 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 32534664 - 32534438
Alignment:
| Q |
1 |
tgagttttggtgacaaattgtatcaagctaggaagcatgtgcaggacatgtctagaataacaagagctcattgacatgtgatgaccaattgtagattcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32534664 |
tgagttttggtgacaaattgtatcaagctaggaagcatgtgtaggacatgtatagaataacaagaggtcattgacatgtgatgaccaattgtagattcta |
32534565 |
T |
|
| Q |
101 |
caagacatgatgggctaagatacaacgtgcaaacttaatataatgctaaaataaaaatacaaattctaaattatactactaaagacatcattgtttctca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32534564 |
caagacatgatgggctaagatacaacgtgcaaacttaatataatgctaacataaaaatacaaattctaaattatactactaaagacatcattgtttctta |
32534465 |
T |
|
| Q |
201 |
agtcagcattagtcattataaaatact |
227 |
Q |
| |
|
|||||||||||||||||||| |||||| |
|
|
| T |
32534464 |
agtcagcattagtcattatataatact |
32534438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 32549992 - 32549959
Alignment:
| Q |
1 |
tgagttttggtgacaaattgtatcaagctaggaa |
34 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
32549992 |
tgagttttggagacaaattgtatcaagctaggaa |
32549959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University