View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201_low_33 (Length: 224)
Name: NF10201_low_33
Description: NF10201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 11 - 207
Target Start/End: Complemental strand, 44892098 - 44891906
Alignment:
| Q |
11 |
agatggacatcatgtaccctgaaacaataagtaactctttttctattcgttttgtttattcatcattacttctttcttggtataggggacaccagaagac |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44892098 |
agatgtacatcatgtaccctgaaacaataagtaactctttttctattcgttttgtttatttatcattacttctttcttggtataggggacaccagaagac |
44891999 |
T |
|
| Q |
111 |
ggctgtgaaagctgcaaaccttaatacttctgttgagattgcaaaaaacacattatttccagtataagtttatggagatcgagaaaaggaataaaca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44891998 |
ggctgtgaaagctgcaaaccttaatacttctgttgagattgcaaaaaacacattatttccagtataagtttatgga----gagaaaaggaataaaca |
44891906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University