View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201_low_35 (Length: 211)
Name: NF10201_low_35
Description: NF10201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 56043820 - 56043983
Alignment:
| Q |
18 |
ataattgcaggcaattgtttatgtttgggtgtataacccaaaatcaaataaatatttgtataacttatatgttaatggttggttattgaatgatggtgat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56043820 |
ataattgcaggcaattgtttatgtttgggtgtataacccaaaatcaaataaatatttgtataacttatatgttaa----tggttattgaatgatggtgat |
56043915 |
T |
 |
| Q |
118 |
gaagtttgt-tttgagtcccgtgaaggttgaacgtggtcgtctagtgtactttatgttcagtgttgaa |
184 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56043916 |
gaagtttgtctttgagtcccgtgaaggttgaacgtggtcgtctagtgtactttatgttcagtgttgaa |
56043983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 47294185 - 47294226
Alignment:
| Q |
18 |
ataattgcaggcaattgtttatgtttgggtgtataacccaaa |
59 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||| ||||| |
|
|
| T |
47294185 |
ataattgcaggcaattgtttttctttgggtgtataatccaaa |
47294226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University