View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201_low_9 (Length: 372)
Name: NF10201_low_9
Description: NF10201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 2e-65; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 216 - 356
Target Start/End: Complemental strand, 429526 - 429389
Alignment:
| Q |
216 |
ttgattactttagtgtagaaaacattcatttttattgcacatttgttgtgttaagaagagtggaattgttgttattttcagcgcttgcaagagggaacat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
429526 |
ttgattactttagtgtagaaaacattcatttttattgcacatttgttgtgttaagaagagtggaattgtt---attttcagcgcttgcaagagggaacat |
429430 |
T |
 |
| Q |
316 |
atatatagcggtaacaccaatagaaaagctcatgtctattg |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
429429 |
atatatagcggtaacaccaatagaaaagctcatgtctattg |
429389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 87 - 215
Target Start/End: Complemental strand, 429712 - 429578
Alignment:
| Q |
87 |
tcctgaggagagtagttcttctggaagtgatcatgtctcaaa------tgatataaacatgaatgcttcttctgtagcttttgttgagtcagacaaggat |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
429712 |
tcctgaggagagtagttcttctggaagtgattatatctcaaaatcaaatgatatcaacatgaatgcttcttctgtagcttttgttgagtcagacaaggat |
429613 |
T |
 |
| Q |
181 |
actaattaaggaggtattattgaagttcttagcca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
429612 |
actaattaaggaggtattattgaagttcttagcca |
429578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 40 - 89
Target Start/End: Complemental strand, 429819 - 429770
Alignment:
| Q |
40 |
aagacgagcatggttatcaacgatgcggcgacactgctacaacggtttcc |
89 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
429819 |
aagacgagcatggttatcaacgatgcggtgacacttctacaacggtttcc |
429770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University